{"id":53,"date":"2023-12-06T15:18:34","date_gmt":"2023-12-06T15:18:34","guid":{"rendered":"https:\/\/sciences.kmics.ac.in\/?page_id=53"},"modified":"2024-01-07T10:10:54","modified_gmt":"2024-01-07T10:10:54","slug":"kiran-kumar-battula-et-al-jan-05-2023","status":"publish","type":"page","link":"https:\/\/sciences.kmics.ac.in\/index.php\/kiran-kumar-battula-et-al-jan-05-2023\/","title":{"rendered":"Kiran Kumar Battula et al, Jan 05, 2023"},"content":{"rendered":"\n
\n
Download PDF<\/a><\/div>\n<\/div>\n\n\n\n

Article Metrics<\/strong><\/a><\/p>\n\n\n\n

Food restriction may not reduce leptin gene expression in obesity condition \u2013 A study with reference to an animal model of obesity, WNIN\/Ob<\/strong><\/h1>\n\n\n\n

Kiran Kumar Battula1,2<\/sup>, Dinesh D.M Yadav2<\/sup>, Naga Muralidhar Merugu2<\/sup>, Prasad SMVK2<\/sup>, Chiranjeevi P V2<\/sup>, Rajender Rao Kalashikam2<\/sup>, Giridharan Nappanveettil*2,3<\/sup>
1<\/sup>Keshav Memorial Institute of Commerce and Sciences, Hyderabad \u2013 500029
2<\/sup>National Institute of Nutrition, Hyderabad-500007
3<\/sup>Amrita Institute of Health Sciences, Kochi, Kerala<\/p>\n\n\n\n

ABSTRACT<\/h2>\n\n\n\n

Objective: Leptin an adipokine, deregulated in many cases of obesity is poorly understood under nutrition interventional strategies like food restriction. The present study addresses the above with the help of a rodent animal model of obesity, WNIN\/Ob
Methods: Male rats of WNIN\/Ob aged 35 days were allotted to three groups (n=4): (1) Rats with lean phenotype and fed ad libitum, (2) Rats with obesity phenotype and fed ad libitum, and (3) Rats with obesity phenotype and subjected to 60% food restriction. Rats were fed up to 90 days age, after which they were assessed for body weights, fat percentages and leptin.
Results: The higher body weights and fat percentages, in rats with obesity phenotype were reversed by food restriction to that of lean phenotype. Circulating leptin levels though showed a significant reduction (1.7 fold), they were significantly high (43 fold) compared to lean phenotype. The relatively high leptin gene expression in food restricted versus ad libitum fed ones (11 fold versus 4 fold with respect to lean) explains the higher circulating leptin levels.
Conclusions: Results suggest that mere food restriction may not reduce leptin gene expression and hence may not be a safer practice to reduce obesity.<\/p>\n\n\n\n

\n\n\n\n

Received<\/strong>: Nov 03, 2022 | Accepted<\/strong>: Dec 15, 2022 | Published<\/strong>: Jan 05, 2023
Keywords<\/strong>: Obesity, Food restriction, Leptin
Citation<\/strong>: Kiran Kumar Battula et al. (2023) Food restriction may not reduce leptin gene expression in obesity condition \u2013 A study with reference to an animal model of obesity, WNIN\/Ob. KMICS Journal of Sciences 1(1). https:\/\/doi.org\/10.62011\/kmicsjs.2023.1.1.5
Competing interests<\/strong>: The authors have declared that no competing interests exist.
Copyright<\/strong>: \u00a92023 Kiran Kumar Battula, Dinesh DM Yadav, Naga Muralidhar Merugu, Prasad SMVK, Chiranjeevi PV, Rajender Rao Kalashikam, Giridharan Nappanveettil. This is an open-access article. The use, distribution, and reproduction of this article in any medium is unrestricted, provided the original author and source are cited.
Correspondence<\/strong>: giridharan.nappanveettil@gmail.com<\/p>\n\n\n\n

\n\n\n\n

INTRODUCTION<\/h2>\n\n\n\n

Obesity or excess body fat was shown to be associated with metabolic syndrome (Metabolic syndrome is a complex of disorders namely dyslipidemia, hypertension, altered hormone signalling, increased pro-inflammatory mediators) and major metabolic diseases like diabetes mellitus, arthritis, cardiovascular disorders, pre-mature ageing, and cancers (1-5). Increase in adipose depots in obesity has been positively correlated with circulating levels of the adipocyte derived satiety signalling hormone \u2018Leptin\u2019, resulting in a hyper-leptinemic condition (6-8).  The physiological levels of leptin seems to be in-effective with a consequent development of leptin resistance in many human subjects with obesity (9-12).<\/p>\n\n\n\n

Food restriction is a common nutrition interventional strategy to reduce obesity and has been reported to ameliorate various facets of the metabolic syndrome like, dyslipidemia, hypertension, oxidative stress, systemic inflammation, cardiovascular disease risk factors, decrease the risk of age associated diseases, increase longevity and even improve cognitive decline (13-17).  Being known to bring the many beneficial effects, its role in leptin gene expression was poorly understood.  While few studies have reported decreased circulating leptin levels upon food restriction (18-20), this reduction was not adequately assessed, particularly with respect to normo-leptinemic \/ healthy condition.  A recent review further highlights many unanswered questions on the regulation of leptin gene expression (21).  The present study was aimed to address the role of food restriction on leptin gene expression with the help of a rodent animal model (WNIN\/Ob) showing genetic inheritance of obesity.<\/p>\n\n\n\n

WNIN\/Ob shows Mendelian inheritance of obesity trait with three phenotypes: -\/- (rats showing obesity phenotype), +\/- (heterozygote \/ carrier rats with incomplete dominant phenotype), and +\/+ (rats with lean or normal phenotype) distinguishable at 35 days age based on body weights and morphological markers.  The rats with obesity phenotype of WNIN\/Ob are hyper-phagic, hyper-lipaemic, hyper-insulinemic, hyper-leptinemic, and show high frequency of age onset degenerative disorders like cataract and retinal degeneration, impaired immunity, tumors, polycystic ovaries, and early ageing (22-27).  WNIN\/Ob is a novel rat strain and shows unique features among the known rodent strains with obesity (28-30).  Being a valuable resource mimicking human metabolic syndrome, the effect of food restriction on leptin gene expression was studied in this animal model.<\/p>\n\n\n\n

MATERIALS AND METHODS<\/h2>\n\n\n\n

Animals, selection, housing and duration of experiment:<\/strong>  Thirty Five days old male rats of lean phenotype (with body weights ranging from 90-120 grams) and rats with obesity phenotype (with body weight ranging from 150-200 grams) of WNIN\/Ob rat strain were divided into 3 groups: (1) Rats of lean phenotype and fed ad libitum<\/em>, (2) Rats with obesity phenotype and fed ad libitum<\/em>, (3) Rats with obesity phenotype and subjected to 60%food restriction. The number of animals each group received was 4 (n=4).  Rats were housed in clean polypropylene cages with sterilized paddy husk as bedding material.  Room temperature was maintained at 22\u00b12\u00b0C with 14-16 air changes per hour and 55\u00b15% relative humidity. Rats were maintained with 12 hour light-dark cycles and had free access to water.  Rats were fed with standard rat chow (AIN 93 grade) till they have attained 90 days of age after which they were they were assessed for body weights, fat percentages and leptin. Rats were sacrificed following institutional animal ethical guidelines and tissue samples were collected.<\/p>\n\n\n\n

Body Weights:<\/strong>  Body weights of rats were measured using standard electronic balance with precision of 0.1 gram (Make: Sartorius, Germany).<\/p>\n\n\n\n

Estimation of Body fat percentage: <\/strong>Total body fat percentage of animals was assessed using TOBEC (Total Body Electrical Conductivity), a small animal body composition analysis system (Make: EM-SCAN\/TOBEC, Model SA-3000 Multi detector, Springfield, III, USA).<\/p>\n\n\n\n

Estimation of circulating leptin:<\/strong> Blood samples were collected from 90 days old rats after 12 hours overnight fasting.  Plasma was separated from the blood and used for estimation of leptin using the kit, Milliplex Map Rat cytokine \/ Chemokine Magnetic Bead Panel (Company: EMD Milllipore, MA, USA; Catalog Number: RECYTMAG-65K).<\/p>\n\n\n\n

RNA isolation & Gene expression:<\/strong> Total RNA was isolated from Adipose tissue using Trizol (Invitrogen) according to manufacturer\u2019s instructions. RNA was converted to cDNA and leptin gene expression was assessed by Real time PCR. Normalization of leptin gene expression was performed against 18S gene expression.  Reagents used for Real time PCR were obtained from Takara Bio (PrimeScript\u2122 RT Reagent Kit, cat#RR037A) and primers from Sigma-Aldrich Co. LLC.  Primer sequences for leptin are, For 5′ ACTTCATTCCCGGGCTTC 3′, and Rev: 5′ GGTCTCGCAGGTTCTCCA 3′.  Primer sequences used for 18s are, For: 5′ GCTTAATTTGACTCAACACGGGA 3′, and Rev: 5′.    AGCTATCAATCTGTCAATCCTGTC 3′.  Leptin gene expression between groups was described as \u2206cq values and fold differences between groups was calculated by 2\u2212\u2206\u2206cq<\/sup> method.<\/p>\n\n\n\n

Statistical methods<\/strong><\/p>\n\n\n\n

Tests for Normality and Homogeniety of variances<\/strong>:  Data was assessed for Normal distribution by Shapiro-Wilk test, skewness and kurtosis.  Levene\u2019s Test of Homogeniety of variances was performed to determine equality of variances between groups.<\/p>\n\n\n\n

Statistical measures and hypothesis testing:<\/strong> Statistical \u2018Range\u2019 as measure of dispersion of the observed data and \u2018Mean\u00b1Standard deviation\u2019, as measure of central tendency and variation was reported for individual groups.  Differences between means were assessed for statistical significance by one way ANOVA followed by post hoc comparisons by LSD (Least Significant Difference).  Upon violation of the assumption of equality of variances for one way ANOVA, Welch F test was conducted followed by Games-Howel post hoc comparison.  One way ANCOVA was further performed to determine differences between groups controlling for a co-variate.   Alpha level was set to 0.05 for all the hypothesis testings.  SPSS statistical software (SPSS for Windows, Version 16.0., Chicago, SPSS Inc) was used for the analysis.<\/p>\n\n\n\n

RESULTS<\/h2>\n\n\n\n

Sample characteristics<\/strong>:  Normality tests performed on all the data sets suggested that the data are approximately normally distributed (Table 1).<\/p>\n\n\n\n

Table 1: Normality test statistics<\/p>\n\n\n\n

Dependent variable<\/td>Indenpendent variable<\/td>Shapiro-Wilk test\n

 <\/p>\n

Statistic  P-value<\/p>\n<\/td>

Skewness\n

 <\/p>\n

Statistic      SE     Z-value<\/p>\n<\/td>

Kurtosis\n

 <\/p>\n

Statistic        SE      Z-value<\/p>\n<\/td><\/tr>

 \n

Body Weight(gms)<\/p>\n

 <\/p>\n

 <\/p>\n

Fat percentage<\/p>\n

 <\/p>\n

 <\/p>\n

Circulating<\/p>\n

leptin levels<\/p>\n

 <\/p>\n

 <\/p>\n

Leptin gene expression in \u2206cq<\/p>\n<\/td>

 \n

Lean_Ad<\/p>\n

Ob_Ad<\/p>\n

Ob_Fr<\/p>\n

 <\/p>\n

Lean_Ad<\/p>\n

Ob_Ad<\/p>\n

Ob _Fr<\/p>\n

 <\/p>\n

Lean_Ad<\/p>\n

Ob_Ad<\/p>\n

Ob _Fr<\/p>\n

 <\/p>\n

Lean_Ad<\/p>\n

Ob_Ad<\/p>\n

Ob _Fr<\/p>\n<\/td>

 \n

0.824        0.153<\/p>\n

0.961        0.785<\/p>\n

0.985        0.931<\/p>\n

 <\/p>\n

0.962        0.790<\/p>\n

0.920        0.538<\/p>\n

0.964        0.804<\/p>\n

 <\/p>\n

0.948        0.706<\/p>\n

0.922        0.546<\/p>\n

0.947        0.700<\/p>\n

 <\/p>\n

0.991        0.962<\/p>\n

0.950        0.713<\/p>\n

0.927        0.580<\/p>\n<\/td>

 \n

1.677        1.014      1.65<\/p>\n

0.314        1.014      0.31<\/p>\n

0.367        1.014      0.36<\/p>\n

 <\/p>\n

0.717        1.014       0.71<\/p>\n

-1.138        1.014     -1.12<\/p>\n

0.391        1.014       0.38<\/p>\n

 <\/p>\n

-0.063        1.014     -0.06<\/p>\n

1.103        1.014      1.08<\/p>\n

-0.902        1.014     -0.88<\/p>\n

 <\/p>\n

0.425        1.014      0.41<\/p>\n

0.768        1.014      0.76<\/p>\n

0.515        1.014      0.51<\/p>\n<\/td>

 \n

3.148        2.619       1.20<\/p>\n

1.487        2.619       0.57<\/p>\n

-1.040        2.619     -0.39<\/p>\n

 <\/p>\n

1.50           2.619      0.57<\/p>\n

0.758         2.619      0.28<\/p>\n

2.021         2.619      0.77<\/p>\n

 <\/p>\n

1.500        2.619       0.57<\/p>\n

2.087        2.619       0.79<\/p>\n

0.023        2.619       0.01<\/p>\n

 <\/p>\n

-0.076        2.619      -0.02<\/p>\n

-0.725        2.619      -0.28<\/p>\n

-2.519        2.619      -0.96<\/p>\n<\/td><\/tr><\/tbody><\/table><\/figure>\n\n\n\n

Normal distribution of data as assessed by Shapiro-Wilk test (p<0.05), and Skewness & Kurtotic Z values  (-1.96 to +1.96).<\/p>\n\n\n\n

Sixty percent food restriction from 35 days age reverses body weights and fat percentages in rats with obesity phenotype to that of lean phenotype. <\/strong><\/p>\n\n\n\n

The body weights ranged from 520-624 grams in rats with obesity phenotype fed ad libitum<\/em>, 275-327 grams in rats of lean phenotype fed ad libitum<\/em> and 183-213 grams in rats with obesity phenotype under food restriction. (Figure 1a).  Variances of the groups being equal (F (2, 9) = 0.897, P=0.441) they were tested for one way ANOVA, which suggested statistically significant differences between groups (F (2, 9) = 179.088, p < 0.001). LSD post hoc comparisons revealed that the body weights of rats with obesity phenotype fed ad libitum<\/em> (569.75\u00b142.5 gms) were statistically significantly high compared to the body weights of rats with lean phenotype fed ad libitum<\/em> (293.5\u00b122.9 gms, p<0.001) and  rats with obesity phenotype under food restriction (197.0\u00b112.9 gms, p<0.001).  The body weights of rats with obesity phenotype under food restriction were also statistically significantly lower compared to rats with lean phenotype fed ad libitum<\/em> (p=0.001).<\/p>\n\n\n\n

The total body fat percentages ranged from 54.9-55.6 in rats with obesity phenotype fed ad libitum<\/em>, 13.9-16.8 in rats with lean phenotype fed ad libitum<\/em> and 12.8-17.6 in rats with obesity phenotype under food restriction (Figure 1b).  Assumption of homogeneity of variances being violated (F (2, 9) = 4.993, P=0.035), Welch F test was performed which suggested statistically significant differences between groups (F (2, 4.324) = 2342, p<0.001).  Games-Howell post hoc comparisons revealed that the body fat percentages in rats with obesity phenotype fed ad libitum<\/em> (55.33\u00b10.3) were statistically significantly high compared to the rats with lean phenotype fed ad libitum<\/em> (15.20\u00b11.2, p<0.001) and rats with obesity phenotype under food restriction (15.0\u00b12.1, p<0.001).  The body fat percentages in rats with obesity phenotype under food restriction and in rats of lean phenotype were comparable (p=0.985).<\/p>\n\n\n\n

Figure 1<\/strong><\/p>\n\n\n\n

\"\"<\/figure>\n\n\n\n

Figure 1.  Comparison of (a) Body weights (gms) and (b) fat percentages among the three groups, (1) Rats with lean phenotype and fed ad libitum <\/em>(Lean_Ad), (2) Rats with obesity phenotype and fed ad libitum<\/em> (Ob_Ad), and (3) Rats with obesity phenotype and subjected to 60% food restriction (Ob_Fr).<\/p>\n\n\n\n

Impaired leptin gene expression is uncorrected by food restriction in rats with obesity phenotype.<\/strong><\/p>\n\n\n\n

Circulating leptin levels (pg\/ml) ranged from 30,381-61,072 in rats with obesity phenotype fed ad libitum<\/em>, 463-695 in rats with lean phenotype fed ad libitum<\/em>, and 19,149-29,794 in rats with obesity phenotype under food restriction.  (Figure 2(a)).  Variances of the groups being equal (F (2, 9) = 3.678, p=0.068) they were tested for one way ANOVA, which suggested statistically significant differences between groups (F (2, 9) = 29.269, p<0.001). LSD post hoc comparisons revealed that circulating leptin levels in rats with obese phenotype fed ad libitum<\/em> (43,200\u00b112,889) were statistically significantly high compared to rats with lean phenotype fed ad libitum<\/em> (580.00\u00b194.7, p<0.001) with a fold difference of 74(43,200\/580).  Food restriction though brought a statistically significant reduction in circulating leptin levels (25,400\u00b14,663.6, p=0.011), with a fold difference of 1.7 (43,200\/25,400) they were statistically significantly high compared to the rats of lean phenotype fed ad libitum<\/em> (p=0.002) with a fold difference of 43.7 (25,400\/580).<\/p>\n\n\n\n

Fat percentages being comparable between rats of lean phenotype fed ad libitum<\/em> and rats with obesity phenotype under food restriction and the assumption of homogeneity of regression being satisfied ((F(1,4) = 2.15, p=0.217) , one way analysis of co-variance (ANCOVA) controlling fat percentage was performed between the two groups for circulating leptin.  ANCOVA results revealed statistically significantly higher leptin levels in rats with obesity phenotype under food restriction (F (1, 5) =197.2, p=0.000; \u03b72<\/sup>=0.97).  The adjusted mean values of circulating leptin are 443.5 and 25,500 respectively in rats of lean phenotype fed ad libitum<\/em> and rats with obesity phenotype under food restriction.<\/p>\n\n\n\n

The \u2206cq values for leptin gene expression (\u2206cq values are inversely proportional to gene expression) ranged from 6.39-7.91 in rats with lean phenotype fed ad libitum<\/em>, 4.72-5.67 in rats with obesity phenotype fed ad libitum<\/em>, and 2.05-5.53 in rats with obesity phenotype under food restriction (Figure 2b). The assumption of homogeneity of variances being violated (F (2, 9) = 6.788, p=0.016), Welch F test was performed which suggested statistically significant differences between groups (F (2, 5.226) = 14.763, p=0.007).  Games-Howell post hoc comparisons revealed that the \u2206cq values in rats with lean phenotype (7.09\u00b10.6) were statistically significantly high compared to the rats with obese phenotype fed ad libitum<\/em>  (5.12\u00b10.4, p=0.008) as well as of rats with obese phenotype under food restriction (3.5\u00b11.6, p=0.033).  The \u2206cq values in rats with obese phenotype fed ad libitum<\/em> versus food restricted were comparable (p=0.273).  The fold differences of leptin gene expression in rats of obesity phenotype, fed ad libitum<\/em> and rats of obesity phenotype under food restriction with respect to rats of lean phenotype were, 3.91 and 11.79. <\/strong><\/p>\n\n\n\n

Figure 2<\/strong><\/p>\n\n\n\n

\"\"<\/figure>\n\n\n\n

Figure 2.  Comparison of (a) circulating Leptin levels and (b) Leptin gene expression (\u2206cq values) among the three groups, (1) Rats with lean phenotype and fed ad libitum <\/em>(Lean_Ad), (2) Rats with obesity phenotype and fed ad libitum<\/em> (Ob_Ad), and (3) Rats with obesity phenotype and subjected to 60% food restriction(Ob_Fr).<\/p>\n\n\n\n

DISCUSSION<\/h2>\n\n\n\n

The present study shows that food restriction believed to be beneficial to health in a condition like obesity, may in fact add a new facet to the metabolic syndrome.  The reduction of leptin levels by food restriction in WNIN\/Ob rats appears to be meagre when these were compared with a normo-leptinemic condition.  An important aspect the present work highlights is the fact that the body fat percentages of rats of lean phenotype fed ad libitum<\/em> and the rats of obesity phenotype subjected to food restriction despite being similar, their circulating leptin levels were not the same indicating that the circulating leptin levels are not indicative of fat percentages in many cases of metabolic syndrome.  The heightened expression of leptin gene in the adipose tissue of rats with obesity phenotype subjected to food restriction suggests for amplification of the molecular signal, increasing the expression of leptin gene.  Recent studies have reported weight regain and relapse towards obesity after discontinuing food restriction(31), and hypotheses like; \u2018activation of anti-starvation mechanisms\u2019 which promotes overeating and obesity (32), \u2018feedback signals from the depletion of fat mass\u2019 modulating energy intake and adaptive thermogenesis and hence increase the risks for fatness (33, 34), \u2018Signals from adipose tissue after energy-restricted weight loss\u2019, a biological drive to regain weight (359), et cetera<\/em> have been suggested by various researchers.  Results from the present study and emerging hypotheses on \u2018food restriction modulated molecular signals\u2019 suggest that the excess accumulation of fat in obesity can be a consequence of \u2018The syndrome X\u2019 in many cases and should be addressed rather diligently than mere food restriction, which can be a nutritional stress and may trigger undesirable responses.<\/p>\n\n\n\n

Acknowledgements:<\/strong>  We are thankful to ICMR for supporting this research work.<\/p>\n\n\n\n

<\/p>\n\n\n\n

REFERENCES<\/h2>\n\n\n\n
    \n
  1. Dixon JB. The effect of obesity on health outcomes. Mol Cell Endocrinol<\/em> 2010; 316:104-108.<\/li>\n\n\n\n
  2. Briggs MS, Spees C, Bout-Tabaku S, Taylor CA, Eneli I, Schmitt LC. Cardiovascular risk and metabolic syndrome in obese youth enrolled in a multidisciplinary medical weight management program: implications of musculoskeletal pain, cardiorespiratory fitness, and health-related quality of life. Metab Syndr Relat Disord<\/em> 2015; 13:102-109.<\/li>\n\n\n\n
  3. Cantiello F, Cicione A,  Salonia A,  Autorino R,  De Nunzio C,  Briganti A,  et al., Association between metabolic syndrome, obesity, diabetes mellitus and oncological outcomes of bladder cancer: A systematic review. Int J Urol<\/em> 2015; 22: 22\u201332.<\/li>\n\n\n\n
  4. Mathers JC. Impact of nutrition on the ageing process. British Journal of Nutrition<\/em> 2015; 113:pp S18-S22.<\/li>\n\n\n\n
  5. Iyengar NM, Hudis CA, Dannenberg AJ. Obesity and cancer: local and systemic mechanisms. Ann Rev Med<\/em> 2015; 66:297-309.<\/li>\n\n\n\n
  6. Friedman JM. Leptin at 14 y of age: an ongoing story. Am J Clin Nutr<\/em> 2009; 89: 973S-979S.<\/li>\n\n\n\n
  7. Sikka G, Yang R, Reid S, Benjo A, Koitabashi N, Camara A et al. Leptin is essential in maintaining normal vascular compliance independent of body weight. Int J Obes (Lond)<\/em> 2010; 34: 203-206.<\/li>\n\n\n\n
  8. Garc\u00eda-Jim\u00e9nez S, Bernal FG, Mart\u00ednez SMF, Monroy NA, Toledano JC, Meneses AA, et al. Serum Leptin is Associated With Metabolic Syndrome in Obese Mexican Subjects. J Clin Lab Anal<\/em> 2015; 29:5-9.<\/li>\n\n\n\n
  9. Park HK, Ahima RS. Physiology of leptin: energy homeostasis, neuroendocrine function and metabolism. Metabolism<\/em> 2015; 64:24-34.<\/li>\n\n\n\n
  10. de Git KC, Adan RA. Leptin resistance in diet-induced obesity: the role of hypothalamic inflammation. Obes Rev<\/em> 2015; 16:207-24.<\/li>\n\n\n\n
  11. S\u00e1inz N, Barrenetxe J, Moreno-Aliaga MJ, Mart\u00ednez JA. Leptin resistance and diet-induced obesity: central and peripheral actions of leptin. Metabolism<\/em> 2015; 64:35-46.<\/li>\n\n\n\n
  12. Paz-Filho G, Mastronardi CA, Licinio J. Leptin treatment: Facts and expectations. Metabolism<\/em> 2015; 64:146-156.<\/li>\n\n\n\n
  13. Dolinsky VW, Morton JS, Oka T, Robillard-Frayne I, Bagdan M, Lopaschuk GD et al. Calorie restriction prevents hypertension and cardiac hypertrophy in the spontaneously hypertensive rat. Hypertension<\/em> 2010; 56: 412-421.<\/li>\n\n\n\n
  14. Louala S, Benyahia-Mostefaoui A, Lamri-Senhadji MY. Energy restriction reduces oxidative stress in the aorta and heart and corrects the atherogenic risk in obese rat. Ann Cardiol Angeiol (Paris)<\/em> 2013; 62:155-60.<\/li>\n\n\n\n
  15. Omodei D, Fontana L. Calorie restriction and prevention of age-associated chronic disease. FEBS Lett<\/em> 2011; 585:1537-42.<\/li>\n\n\n\n
  16. Rizza W, Veronese N, Fontana L. What are the roles of calorie restriction and diet quality in promoting healthy longevity? Ageing Res Rev<\/em> 2014; 13:38-45.<\/li>\n\n\n\n
  17. Kishi T, Hirooka Y, Nagayama T, Isegawa K, Katsuki M, Takesue K, Sunagawa K. Calorie restriction improves cognitive decline via up-regulation of brain-derived neurotrophic factor: tropomyosin-related kinase B in hippocampus ofobesity-induced hypertensive rats. Int Heart J<\/em> 2015; 56:110-5.<\/li>\n\n\n\n
  18. Klempel MC, Varady KA. Reliability of leptin, but not adiponectin, as a biomarker for diet-induced weight loss in humans. Nutr Rev<\/em> 2011; 69:145-54.<\/li>\n\n\n\n
  19. Takatsu M, Nakashima C, Takahashi K, Murase T, Hattori T, Ito H et al. Calorie restriction attenuates cardiac remodeling and diastolic dysfunction in a rat model of metabolic syndrome. Hypertension<\/em> 2013; 62:957-965.<\/li>\n\n\n\n
  20. Escriv\u00e1 F, Gavete ML, Ferm\u00edn Y, P\u00e9rez C, Gallardo N, Alvarez C et al. Effect of age and moderate food restriction on insulin sensitivity in Wistar rats: role of adiposity. J Endocrinol<\/em> 2007; 194:131-141.<\/li>\n\n\n\n
  21. Friedman JM, Mantzoros CS. 20 years of leptin: from the discovery of the leptin gene to leptin in our therapeutic armamentarium. Metabolism<\/em> 2015; 64:1-4.<\/li>\n\n\n\n
  22. Giridharan N, Harishankar N, Satyavani M. A new rat model for the study of Obesity. Scand J Lab Anim Sci<\/em> 1996; 23: 131-137.<\/li>\n\n\n\n
  23. Harishankar N, Kumar PU, Sesikeran B, Giridharan N. Obesity associated pathophysiological & histological changes in WNIN obese mutant rats. Indian J Med Res <\/em>2011; 134:330-40.<\/li>\n\n\n\n
  24. Harishankar N, Ravinder P, Nair KM, Giridharan N. Infertility in WNIN Obese Mutant Rats-Causes? ISRN Endocrinol<\/em> 2011; 2011:863403.<\/li>\n\n\n\n
  25. Bandaru P, Rajkumar H, Nappanveettil G. Altered or impaired immune response upon vaccination in WNIN\/Ob rats. Vaccine<\/em> 2011; 29:3038-3042.<\/li>\n\n\n\n
  26. Reddy PY, Giridharan NV, Balakrishna N, Validandi V, Pullakhandam R, Reddy GB. Increased risk of cataract development in WNIN-obese rats due to accumulation of intralenticular sorbitol. IUBMB Life<\/em>. 2013; 65:472-478.<\/li>\n\n\n\n
  27. Reddy SS, Shruthi K, Reddy VS, Raghu G, Suryanarayana P, Giridharan NV, Reddy GB. Altered ubiquitin-proteasome system leads to neuronal cell death in a spontaneous obese rat model. Biochim Biophys Acta<\/em> 2014; 1840:2924-2934.<\/li>\n\n\n\n
  28. Giridharan NV. Animal models of obesity & their usefulness in molecular approach to obesity. Indian J Med Res<\/em> 1998; 108:225-242.<\/li>\n\n\n\n
  29. Kalashikam RR, Battula KK, Kirlampalli V, Friedman JM, Nappanveettil G. Obese locus in WNIN\/obese rat maps on chromosome 5 upstream of leptin receptor. PLoS One<\/em> 2013; 8: e77679.<\/li>\n\n\n\n
  30. Genetic Relatedness of WNIN and WNIN\/Ob with Major Rat Strains in Biomedical Research. Battula KK, Nappanveettil G, Nakanishi S, Kuramoto T, Friedman JM, Kalashikam RR. Biochem Genet<\/em> 2015; 53:132-40.<\/li>\n\n\n\n
  31. Sumithran P, Proietto J. The defence of body weight: a physiological basis for weight regain after weight loss. Clin Sci (Lond)<\/em> 2013; 124:231-241.<\/li>\n\n\n\n
  32. Ochner CN, Barrios DM, Lee CD, Pi-Sunyer FX. Biological mechanisms that promote weight regain following weight loss in obese humans. Physiol Behav<\/em> 2013; 120:106-113.<\/li>\n\n\n\n
  33. Dulloo AG, Jacquet J, Montani JP, Schutz Y. How dieting makes the lean fatter: from a perspective of body composition autoregulation through adipostats and proteinstats awaiting discovery. Obes Rev<\/em> 2015; 16: Suppl1:25-35.<\/li>\n\n\n\n
  34. Dulloo AG, Montani JP. Pathways from dieting to weight regain, to obesity and to the metabolic syndrome: an overview. Obes Rev<\/em> 2015; 16: Suppl 1:1-6.<\/li>\n\n\n\n
  35. MacLean PS, Higgins JA, Giles ED, Sherk VD, Jackman MR. The role for adipose tissue in weight regain after weight loss. Obesity Reviews<\/em> 2015; 16:45\u201354.<\/li>\n<\/ol>\n\n\n\n
    \n\n\n\n
    \n
    \n

    <\/a>Article Metrics | Page views: <\/p>\n<\/div>\n\n\n\n

    \n\r\n
    N\/A<\/div>\n<\/div>\n\n\n\n
    Download count: <\/span>0<\/span> Downloads<\/span><\/div>\n<\/div>\n<\/div>\n","protected":false},"excerpt":{"rendered":"

    Article Metrics Food restriction may not reduce leptin gene expression in obesity condition \u2013 A study with reference to an animal model of obesity, WNIN\/Ob Kiran Kumar Battula1,2, Dinesh D.M Yadav2, Naga Muralidhar Merugu2, Prasad SMVK2, Chiranjeevi P V2, Rajender Rao Kalashikam2, Giridharan Nappanveettil*2,3 1Keshav Memorial Institute of Commerce and Sciences, Hyderabad \u2013 500029 2National […]<\/p>\n","protected":false},"author":1,"featured_media":0,"parent":0,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"om_disable_all_campaigns":false,"_monsterinsights_skip_tracking":false,"_monsterinsights_sitenote_active":false,"_monsterinsights_sitenote_note":"","_monsterinsights_sitenote_category":0,"footnotes":""},"class_list":["post-53","page","type-page","status-publish","hentry"],"aioseo_notices":[],"_links":{"self":[{"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/pages\/53","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/comments?post=53"}],"version-history":[{"count":5,"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/pages\/53\/revisions"}],"predecessor-version":[{"id":191,"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/pages\/53\/revisions\/191"}],"wp:attachment":[{"href":"https:\/\/sciences.kmics.ac.in\/index.php\/wp-json\/wp\/v2\/media?parent=53"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}